Drugs Information Online
Drugs and diseases reference index

Drugs and diseases reference index
Search
EN

Definition of «Telomere»

TelomereTelomere

Telomere: The end of a chromosome, a specialized structure involved in the replication and stability of the chromosome.

On the DNA level, the telomere is a dull stretch of road. It is a length of DNA monotonously made up of a recurring motif of 6 nucleotide bases (namely, the sequence TTAGGG) together with various associated proteins. The TTAGGG motif is tandemly repeated. It reads TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG and so on.

Small amounts of these terminal TTAGGG sequences are lost from the tips of the chromosomes, but the addition of TTAGGG repeats by the enzyme telomerase compensates for this loss.

Many human cells progressively lose terminal TTAGGG sequences from their chromosomes during the process of cell division, a loss that correlates with the apparent absence of the telomerase enzyme in these cells.

Telomerase appears to play a role in the formation, maintenance, and renovation of telomeres. There has been great interest in the possible relationship between human telomeres in the one hand and cellular senescence(aging) and cellular immortality on the other. This interest includes the question of a role for telomerase in the malignant process and the question of the use of agents that inhibit telomerase as anti-tumor agents.

(In biochemical terms, telomerase acts as a telomerase-reverse transcriptase (TERT); it reverses the usual course of nucleic acid events (from DNA to RNA) and goes from RNA to DNA; it transcribes the RNA into DNA and so is a reverse-transcribing enzyme specific to the telomeric sequence. Telomerase is itself a ribonucleoprotein (a complex of RNA and protein). It has two unique features: it is able to recognize a single-stranded (G-rich) telomere primer and it is able to add multiple telomeric repeats to its end by using an RNA template.)

A gene coding for telomerase has been located and "mapped" to chromosome subband 5p15.33.

For More Information «Telomere»

  • telomere: Definition from Answers.com

    Library > Literature & Language > Dictionary ( tĕl ' ə-mîr ' , tē ' lə- ) n. Either of the sections of DNA occurring at the ends of a chromosome.

  • Telomeres: Your Key To Increase Longevity & Quality Of Life

    If you are interested in learning more about telomere biology and aging visit these sites: Telomere Science Library Pub Med Sierra Sciences Note, the sites you are about ...

  • Telomere.net

    Telomere.net Telomeres Telomeres are sequences at the ends of chromosomes. Though they are written in the 'alphabet' of the genes, telomeres do not contain the codes for ...

  • Telomeres

    Telomerase is an enzyme that adds telomere repeat sequences to the 3' end of DNA strands. By lengthening this strand, DNA polymerase is able to complete the synthesis of ...

  • Are Telomeres the Key to Aging and Cancer?

    Fluorescence-stained chromosomes (red) on a microscope slide. Telomere sequences (yellow) reside at the ends of each chromosome.

Comment «Telomere»